Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
has_circ_0001946 | |||
Gene | Organism | Human | |
Genome Locus | Build | hg19 | |
Disease | Lung Adenocarcinoma | ICD-10 | Malignant neoplasm of bronchus and lung (C34) |
DBLink | PMID | 30841451 | |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | Fresh cancerous tissues of primary LAC and normal paracancerous tissues |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CGGGTCTTCCAGGAAATCCG ReverseTCCGGAAGATGTGGATTGACTG | Statistics | Fold Change : Upregulated pvalue : <0.05 |
Citation | |||
Yao, Y, Hua, Q, Zhou, Y, Shen, H (2019). CircRNA has_circ_0001946 promotes cell growth in lung adenocarcinoma by regulating miR-135a-5p/SIRT1 axis and activating Wnt/펲-catenin signaling pathway. Biomed. Pharmacother., 111:1367-1375. |